Gamma Gliadin will bind to the APC receptor and initiate an inflammatory response. Antisense protein can either make a cluster of Gamma gliadin hence not making them available to initiate the reaction. The other possible method is that it interrupts with tTG enzyme that mediates this reaction and modifies Gliadin. Once tTG action is interrupted it will not modify peptides hence these will not be sensitive to T-lymphocytes to initiate any reaction.
The double helix DNA has two complementary parallel chains, a sense chain, and an antisense chain. The antisense chain encodes antisense peptides, which then unfolds into an antisense protein. By using the antisense technique a complementary RNA is produced against the target RNA. The resultant antisense protein will bind with gamma Gliadin and form a fusion. A complementary sequence of the gene will block transcription from the target gene (Hansen et al 2007).
Mutagenesis and gene technology approaches have shown that RNA regulation of protein construction is possible to produce such antisense proteins that will interact with Gamma Gliadin and hence preventing the occurrence of celiac disease. By antisense RNA technology it is possible to improve the nutritional content of the seeds and modify the proportions of major storage proteins (Hansen et al, 2007).
mRNA is a single-stranded sequence of nucleotides that is called ‘sense’ because it transcribes protein. While its complementary RNA is antisense (Chou, Zhang & Elrod, 1996). mRNA can form a duplex with antisense RNA resulting in a double-stranded RNA which then inhibits gene expression. Hence antisense RNA will suppress gene expression by binding to mRNA. Similarly, if another mRNA is introduced in the cell though it doesn’t bind previous mRNA but it also suppresses gene expression. The artificially prepared mRNA has some contamination of antisense RNA hence both sense and antisense bind to form a helix which is then the original cause of suppression in Gene expression.
Thus the mRNA that transcribes Gamma Gliadin can be inhibited by introducing antisense RNA exact complimentary to the mRNA that transcribes Gamma Gliadin, hence blocking it’s production.
5′- CATGGATCCTTAGCCAATGAACGGTGGTTGTTGTTGGGGGA – 3′.
With mRNA regulation antisense protein can be produced that binds to Gamma Gliadin forming a fusion protein hence it’s not available to bind intestinal wall. The specific antisense protein must be complementary to gamma gliadin and must have affinity for the receptors binding sites. Once receptor binding sites of Gamma Gliadin are occupied the gliadin protein does not initiate any reaction and celiac disease is not produced.
Gluten peptides bind to particular receptors present on the antigen presenting cells in small intestine HLA-DQ2 and HLA-DQ8. With this binding gluten is exposed to gluten sensitive T-cells (Koning, 2003; Vader et al.,2002) which initiate a cascade of immunological reaction. The T-cell activated gluten peptides have abundance amount of neutral amino acid glutamine. The MHC receptors present on antigen presenting cells have preference for negatively charged amino acids.
An enzyme, tTG [tissue transglutaminase] is involved in tissue repair and is present in the intestinal wall. Glutamine can be converted to glutamate by deamidating process by tTG enzyme, hence it’s affinity to HLA receptors increases. Since, exposure to gluten diet and occurrence of Celiac disease is strongly related (Ivarsson et al., 2000; Fasano, 2006; Ventura et al., 1999) and it’s almost impossible to avoid gluten in diet, there should be a way to block gamma gliadin to initiate its cascade of reaction.
Once the gluten is bound to APC receptors, T-lymphocytes are activated and release cytokines which initiate chain of inflammatory reactions that damages intestinal villi. With antisense protein interfering in this reaction and binding gliadin will inhibit any such reaction.
Tissue transglutaminase plays a major role in pathogenesis of celiac disease. It modifies specific glutamine by deamiation which are recognized by T-lymphocytes (CD4+) cells. Blocking tTG can also inhibit this chain reaction that causes celian disease. Hence a protein that inhibits functioning of tTG can stop from these chain reactions to occur.
References
Chou, Kuo-Chen., Zhang, Chun-Ting & Elrod, D.W. (1996) Do Anti-sense Proteins Exist? Journal of Protein Chemistry Vol. 15, No. 1.
Fasano A (2006) Systemic autoimmune disorders in celiac disease. Curr Opin Gastroenterol, 22:674-679.
Ivarsson A, Persson LA, Nystrom L, Ascher H, Cavell B, Danielsson L, Dannæus A, Lindberg T, Lindquist B, Stenhammar L and Hernell O (2000) Epidemic of coeliac disease in Swedish children. Acta Paediatr, 89:165-171.
Koning F (2003) The molecular basis of celiac disease. J Mol Recognit, 16:333-336.
Michael Hansen1, Mette Lange1, Carsten Friis2, Giuseppe Dionisio1, Preben Bach Holm1 and Eva Vincze (2007) Antisense-mediated suppression of C-hordein biosynthesis in the barley grain results in correlated changes in the transcriptome, protein profile, and amino acid composition. Journal of Experimental Botany, Vol. 58, No. 14, pp. 3987–3995, 2007
Vader W, Kooy Y, Van Veelen P, De Ru A, Harris D, Benckhuijsen W, Peña S, Mearin L, Drijfhout JW and Koning F (2002) The gluten response in children with celiac disease is directed toward multiple gliadin and glutenin peptides. Gastroenterology, 122:1729-1737.
Ventura A, Magazzu G and Greco L (1999) Duration of exposure to gluten and risk for autoimmune disorders in patients with celiac disease. SIGEP Study Group for Autoimmune Disorders in Celiac Disease. Gastroenterology, 117:297-303.